The structure of cellulose nanomaterials is definitized by random deposition and can’t change in response to shifting software necessities. Herein, we current a magnetic field-controlled cellulose movie derived from wooden that reveals nice magnetic properties and dependable tunability enabled by included Fe3O4 nanoparticles and cellulose nanofibers (CNF) with a big length-diameter ratio. Fe3O4 nanoparticles are dispersed in suspensions of CNF in order to boost the magnetic response. The airplane magnetic CNF might be processed to type a three-dimensional (3D) flower-like construction alongside the magnetic induction line after making use of an exterior magnet.

Impressed by the fluidic transport in pure flowers, a bilayer construction was created utilizing the 3D flower-like movie because the photo voltaic power receiver and pure wooden because the water pathway in a solar-derived evaporation system. In contrast with a planar cellulose movie embellished with Fe3O4, the 3D construction design can drastically enhance the evaporation fee from 1.19 to 1.39 kg m-2 h-1 and the effectivity from 76.9 to 90.6% underneath 1 solar. Finite component molding additional reveals that the 3D structural prime layer is useful for the formation of a gradient temperature profile and the advance of the power effectivity via the discount of thermal radiation.

The magnetically managed fabrication represents a promising technique for designing cellulose nanomaterials with an advanced construction and controllable topography, which has a large spectrum of purposes in power storage units and water therapy. Though the transition to renewable energies will intensify the worldwide competitors for land, the potential impacts pushed by photo voltaic power stay unexplored. On this work, the potential photo voltaic land necessities and associated land use change emissions are computed for the EU, India, Japan and South Korea. A novel methodology is developed inside an built-in evaluation mannequin which hyperlinks socioeconomic, power, land and local weather techniques.

At 25-80% penetration within the electrical energy mixture of these areas by 2050, we discover that photo voltaic power could occupy 0.5-5% of whole land. The ensuing land cowl adjustments, together with oblique results, will probably trigger a internet launch of carbon starting from Zero to 50 gCO2/kWh, relying on the area, scale of enlargement, photo voltaic expertise effectivity and land administration practices in photo voltaic parks. Therefore, a coordinated planning and regulation of latest photo voltaic power infrastructures must be enforced to keep away from a big improve of their life cycle emissions via terrestrial carbon losses.

Shadow enhanced self-charging energy system for wave and photo voltaic power harvesting from the ocean

Hybrid energy-harvesting techniques that seize each wave and photo voltaic power from the oceans utilizing triboelectric nanogenerators and photovoltaic cells are promising renewable power options. Nonetheless, ubiquitous shadows forged from transferring objects in these techniques are undesirable as they degrade the efficiency of the photovoltaic cells. Right here we report a shadow-tribo-effect nanogenerator that hybrids tribo-effect and shadow-effect collectively to beat this problem. A number of fiber-supercapacitors are built-in with the shadow-tribo-effect nanogenerator to type a self-charging energy system. To seize and retailer wave/photo voltaic power from oceans, an power ball based mostly on the self-charging energy system is demonstrated.

By harnessing the shadow-effect, i.e. the shadow of the transferring object within the power ball, the charging time shortens to 253.Three s to cost the fiber-supercapacitors to the identical voltage (0.Three V) as utilizing pure tribo-effect. This cost-effective methodology to reap and retailer the wave/photo voltaic power from the oceans on this work is anticipated to encourage next-generation large-scale blue power harvesting.  With the depletion of fossil power, photo voltaic power has steadily attracted folks’s consideration.

Dye-sensitized photo voltaic cells have developed quickly in recent times as a result of their low value and excessive conversion effectivity. On this article, based mostly on the theoretical analysis on the photovoltaic parameters of DSSCs within the early levels of the analysis workforce, we’ve got made an correct prediction of J scV oc, and PCE of C286. (The error in our predicted PCE values was 3.33% relative to the experiment.) Additionally, we additional designed a sequence of latest dyes CH1-CH5 by introducing donors and co-acceptors with C286-C288 because the prototype utilizing the DFT/TDDFT methodology.

The PCE of the designed dyes CH2-CH5 exceed the given dye C286, particularly the CH3 and CH4 obtained the PCE of 26.2 and 14.5%. This means the proposed dyes supply a dramatic enchancment on PCE for DSSC units. Furthermore, the designed dyes corresponding to CH3 and CH4 have nice potential to be utilized to photovoltaic purposes, additional enabling the design of novel, extremely environment friendly photoactive supplies. The collected clear water from the solar-steam evaporators reached the emission requirements of EU Water Framework Directive (91/271/EEC).

Magnetically Driven 3D Cellulose Film for Improved Energy Efficiency in Solar Evaporation

Value-effective useful resource utilization for waste biomass: A easy preparation methodology of photo-thermal biochar muffins (BCs) towards dye wastewater therapy with photo voltaic power

Waste biomass and dye wastewater pollutions have been the intense environmental issues. The interfacial solar-steam era expertise is an efficient and sustainable methodology for the water purification. Nonetheless, the advanced preparation course of, excessive financial value and doubtless secondary environmental air pollution of conventional photo-thermal supplies restricted their sensible large-scale software. Herein, the biochar muffins (BCs) deriving from waste biomass have been ready, and the granular and schistose MgO coatings have been dressed on the floor of carbonized fiber to enhance their hydrophilicity.

UPK2 Uroplakin 2 Human Recombinant Protein

PROTO00526 Regular: 20ug
EUR 317
Description: UPK2 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 153 amino acids (26-155 a.a) and having a molecular mass of 16.2kDa.;UPK2 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Recombinant Human UPK2 Protein, His, E.coli-1mg

QP13897-1mg 1mg
EUR 2757

Recombinant Human UPK2 Protein, His, E.coli-20ug

QP13897-20ug 20ug
EUR 201

Recombinant Human UPK2 Protein, His, E.coli-5ug

QP13897-5ug 5ug
EUR 155

Recombinant Uroplakin 2 (UPK2)

4-RPF561Hu01
  • EUR 368.80
  • EUR 202.00
  • EUR 1108.00
  • EUR 436.00
  • EUR 772.00
  • EUR 310.00
  • EUR 2620.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O00526
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 17.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Uroplakin 2 expressed in: E.coli

Human Uroplakin 2 (UPK2) Protein

20-abx650668
  • EUR 523.00
  • EUR 244.00
  • EUR 1497.00
  • EUR 606.00
  • EUR 384.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

UPK2 siRNA

20-abx939075
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

UPK2 antibody

70R-21174 50 ul
EUR 435
Description: Rabbit polyclonal UPK2 antibody

UPK2 Antibody

1-CSB-PA025656GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against UPK2. Recognizes UPK2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Uroplakin-2 (UPK2) Protein

20-abx261408
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

UPK2 protein (His tag)

30R-2967 100 ug
EUR 322
Description: Purified recombinant Human UPK2 protein (His tag)

Recombinant Human Uroplakin-2/UPK2 (C-6His)

CA11-10ug 10ug
EUR 202
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Recombinant Human Uroplakin-2/UPK2 (C-6His)

CA11-1mg 1mg
EUR 2283
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Recombinant Human Uroplakin-2/UPK2 (C-6His)

CA11-500ug 500ug
EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Recombinant Human Uroplakin-2/UPK2 (C-6His)

CA11-50ug 50ug
EUR 496
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

UPK2 ELISA KIT|Human

EF004088 96 Tests
EUR 689

Human UPK2 shRNA Plasmid

20-abx955048
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

UPK2 cloning plasmid

CSB-CL025656HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 555
  • Sequence: ATGGCACCCCTGCTGCCCATCCGGACCTTGCCCTTGATCCTGATTCTGCTGGCTCTGCTGTCCCCAGGGGCTGCAGACTTCAACATCTCAAGCCTCTCTGGTCTGCTGTCCCCGGCACTAACGGAGAGCCTGCTGGTTGCCTTGCCCCCCTGTCACCTCACAGGAGGCAATGCCAC
  • Show more
Description: A cloning plasmid for the UPK2 gene.

anti- UPK2 antibody

FNab09274 100µg
EUR 548.75
  • Recommended dilution: WB: 1:200-1:2000
  • IHC:1:20-1:200
  • Immunogen: uroplakin 2
  • Uniprot ID: O00526
  • Gene ID: 7379
  • Research Area: Developmental biology
Description: Antibody raised against UPK2

anti- UPK2 antibody

FNab09275 100µg
EUR 585
  • Recommended dilution: IHC:1:20-1:200
  • Immunogen: uroplakin 2
  • Uniprot ID: O00526
  • Gene ID: 7379
  • Research Area: Developmental biology
Description: Antibody raised against UPK2

UPK2 Rabbit pAb

A10813-100ul 100 ul
EUR 308

UPK2 Rabbit pAb

A10813-200ul 200 ul
EUR 459

UPK2 Rabbit pAb

A10813-20ul 20 ul
EUR 183

UPK2 Rabbit pAb

A10813-50ul 50 ul
EUR 223

UPK2 Rabbit pAb

A3338-100ul 100 ul
EUR 308

UPK2 Rabbit pAb

A3338-200ul 200 ul
EUR 459

UPK2 Rabbit pAb

A3338-20ul 20 ul Ask for price

UPK2 Rabbit pAb

A3338-50ul 50 ul Ask for price

UPK2 Polyclonal Antibody

27504-100ul 100ul
EUR 252

UPK2 Polyclonal Antibody

27504-50ul 50ul
EUR 187

Anti-UPK2 antibody

PAab09274 100 ug
EUR 386

Anti-UPK2 antibody

STJ26047 100 µl
EUR 277
Description: This gene encodes one of the proteins of the highly conserved urothelium-specific integral membrane proteins of the asymmetric unit membrane which forms urothelium apical plaques in mammals. The asymmetric unit membrane is believed to strengthen the urothelium by preventing cell rupture during bladder distention. The encoded protein is expressed in the peripheral blood of bladder cancer patients with transitional cell carcinomas.

Anti-UPK2 antibody

STJ112709 100 µl
EUR 277
Description: This gene encodes one of the proteins of the highly conserved urothelium-specific integral membrane proteins of the asymmetric unit membrane which forms urothelium apical plaques in mammals. The asymmetric unit membrane is believed to strengthen the urothelium by preventing cell rupture during bladder distention. The encoded protein is expressed in the peripheral blood of bladder cancer patients with transitional cell carcinomas.

UPK2 ORF Vector (Human) (pORF)

ORF014895 1.0 ug DNA
EUR 354

UPK2 ELISA Kit (Human) (OKCD00470)

OKCD00470 96 Wells
EUR 831
Description: Description of target: Component of the asymmetric unit membrane (AUM); a highly specialized biomembrane elaborated by terminally differentiated urothelial cells. May play an important role in regulating the assembly of the AUM (By similarity).By similarity ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.053 ng/mL

UPK2 ELISA Kit (Human) (OKAN06386)

OKAN06386 96 Wells
EUR 792
Description: Description of target: This gene encodes one of the proteins of the highly conserved urothelium-specific integral membrane proteins of the asymmetric unit membrane which forms urothelium apical plaques in mammals. The asymmetric unit membrane is believed to strengthen the urothelium by preventing cell rupture during bladder distention. The encoded protein is expressed in the peripheral blood of bladder cancer patients with transitional cell carcinomas.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.053 ng/mL

UPK2 Protein Vector (Human) (pPB-C-His)

PV059577 500 ng
EUR 481

UPK2 Protein Vector (Human) (pPB-N-His)

PV059578 500 ng
EUR 481

UPK2 Protein Vector (Human) (pPM-C-HA)

PV059579 500 ng
EUR 481

UPK2 Protein Vector (Human) (pPM-C-His)

PV059580 500 ng
EUR 481

UPK2 Polyclonal Conjugated Antibody

C27504 100ul
EUR 397

Uroplakin-2 (UPK2) Antibody

20-abx126762
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Uroplakin 2 (UPK2) Antibody

20-abx116547
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Uroplakin 2 (UPK2) Antibody

20-abx131673
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Uroplakin-2 (UPK2) Antibody

20-abx002383
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Uroplakin-2 (UPK2) Antibody

abx239274-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Mouse Uroplakin-2 (Upk2)

1-CSB-EP025656MO
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 40.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Uroplakin-2(Upk2) expressed in E.coli

Human Uroplakin- 2, UPK2 ELISA KIT

ELI-36740h 96 Tests
EUR 824

Human Uroplakin 2 (UPK2) ELISA Kit

20-abx156911
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Uroplakin 2 (UPK2) CLIA Kit

20-abx494951
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

UPK2 sgRNA CRISPR Lentivector set (Human)

K2591901 3 x 1.0 ug
EUR 339

Uroplakin 2 (UPK2) Polyclonal Antibody (Human)

4-PAF561Hu01
  • EUR 261.00
  • EUR 2734.00
  • EUR 676.00
  • EUR 330.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UPK2 (Asp26~Thr153)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Uroplakin 2 (UPK2)

Human Uroplakin 2 ELISA Kit (UPK2)

RK02481 96 Tests
EUR 521

Human Uroplakin 2(UPK2)ELISA Kit

QY-E02051 96T
EUR 374

Human Uroplakin 2 (UPK2) ELISA Kit

SEF561Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Uroplakin 2 (UPK2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uroplakin 2 (UPK2) in tissue homogenates, cell lysates and other biological fluids.

Human Uroplakin 2 (UPK2) ELISA Kit

SEF561Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Uroplakin 2 (UPK2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uroplakin 2 (UPK2) in tissue homogenates, cell lysates and other biological fluids.

Human Uroplakin 2 (UPK2) ELISA Kit

SEF561Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Uroplakin 2 (UPK2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uroplakin 2 (UPK2) in tissue homogenates, cell lysates and other biological fluids.

Human Uroplakin 2 (UPK2) ELISA Kit

SEF561Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Uroplakin 2 (UPK2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uroplakin 2 (UPK2) in tissue homogenates, cell lysates and other biological fluids.

Human Uroplakin 2 (UPK2) ELISA Kit

4-SEF561Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Uroplakin 2 elisa. Alternative names of the recognized antigen: UPII
  • Uroplakin II
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Uroplakin 2 (UPK2) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

UPK2 Protein Vector (Rat) (pPB-C-His)

PV314586 500 ng
EUR 603

UPK2 Protein Vector (Rat) (pPB-N-His)

PV314587 500 ng
EUR 603

UPK2 Protein Vector (Rat) (pPM-C-HA)

PV314588 500 ng
EUR 603

UPK2 Protein Vector (Rat) (pPM-C-His)

PV314589 500 ng
EUR 603

UPK2 Protein Vector (Mouse) (pPB-C-His)

PV244278 500 ng
EUR 603

UPK2 Protein Vector (Mouse) (pPB-N-His)

PV244279 500 ng
EUR 603

UPK2 Protein Vector (Mouse) (pPM-C-HA)

PV244280 500 ng
EUR 603

UPK2 Protein Vector (Mouse) (pPM-C-His)

PV244281 500 ng
EUR 603

Uroplakin 2 (UPK2) Antibody (Cy3)

20-abx274287
  • EUR 592.00
  • EUR 286.00
  • EUR 1887.00
  • EUR 857.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Upk2 ORF Vector (Rat) (pORF)

ORF078647 1.0 ug DNA
EUR 506

Upk2 ORF Vector (Mouse) (pORF)

ORF061070 1.0 ug DNA
EUR 506

ELISA kit for Human UPK2 (Uroplakin 2)

ELK5223 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Uroplakin 2 (UPK2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Uroplakin 2 (UP
  • Show more
Description: A sandwich ELISA kit for detection of Uroplakin 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

UPK2 sgRNA CRISPR Lentivector (Human) (Target 1)

K2591902 1.0 ug DNA
EUR 154

UPK2 sgRNA CRISPR Lentivector (Human) (Target 2)

K2591903 1.0 ug DNA
EUR 154

UPK2 sgRNA CRISPR Lentivector (Human) (Target 3)

K2591904 1.0 ug DNA
EUR 154

Uroplakin 2 (UPK2) Polyclonal Antibody (Human), APC

4-PAF561Hu01-APC
  • EUR 367.00
  • EUR 3581.00
  • EUR 989.00
  • EUR 470.00
  • EUR 228.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UPK2 (Asp26~Thr153)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Uroplakin 2 (UPK2). This antibody is labeled with APC.

Uroplakin 2 (UPK2) Polyclonal Antibody (Human), Biotinylated

4-PAF561Hu01-Biotin
  • EUR 327.00
  • EUR 2684.00
  • EUR 783.00
  • EUR 403.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UPK2 (Asp26~Thr153)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Uroplakin 2 (UPK2). This antibody is labeled with Biotin.

Uroplakin 2 (UPK2) Polyclonal Antibody (Human), Cy3

4-PAF561Hu01-Cy3
  • EUR 447.00
  • EUR 4733.00
  • EUR 1277.00
  • EUR 585.00
  • EUR 263.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UPK2 (Asp26~Thr153)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Uroplakin 2 (UPK2). This antibody is labeled with Cy3.

Uroplakin 2 (UPK2) Polyclonal Antibody (Human), FITC

4-PAF561Hu01-FITC
  • EUR 313.00
  • EUR 2884.00
  • EUR 811.00
  • EUR 396.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UPK2 (Asp26~Thr153)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Uroplakin 2 (UPK2). This antibody is labeled with FITC.

Uroplakin 2 (UPK2) Polyclonal Antibody (Human), HRP

4-PAF561Hu01-HRP
  • EUR 334.00
  • EUR 3120.00
  • EUR 873.00
  • EUR 424.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UPK2 (Asp26~Thr153)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Uroplakin 2 (UPK2). This antibody is labeled with HRP.

Uroplakin 2 (UPK2) Polyclonal Antibody (Human), PE

4-PAF561Hu01-PE
  • EUR 313.00
  • EUR 2884.00
  • EUR 811.00
  • EUR 396.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UPK2 (Asp26~Thr153)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Uroplakin 2 (UPK2). This antibody is labeled with PE.

Uroplakin 2 (UPK2) Polyclonal Antibody (Human), APC-Cy7

4-PAF561Hu01-APC-Cy7
  • EUR 614.00
  • EUR 7042.00
  • EUR 1858.00
  • EUR 821.00
  • EUR 337.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UPK2 (Asp26~Thr153)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Uroplakin 2 (UPK2). This antibody is labeled with APC-Cy7.

Mouse Uroplakin- 2, Upk2 ELISA KIT

ELI-36741m 96 Tests
EUR 865

Bovine Uroplakin- 2, UPK2 ELISA KIT

ELI-28839b 96 Tests
EUR 928

Porcine Uroplakin- 2, UPK2 ELISA KIT

ELI-39864p 96 Tests
EUR 928

Upk2 sgRNA CRISPR Lentivector set (Mouse)

K3928801 3 x 1.0 ug
EUR 339

Upk2 sgRNA CRISPR Lentivector set (Rat)

K6692301 3 x 1.0 ug
EUR 339

Upk2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3928802 1.0 ug DNA
EUR 154

Upk2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3928803 1.0 ug DNA
EUR 154

Upk2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3928804 1.0 ug DNA
EUR 154

Upk2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6692302 1.0 ug DNA
EUR 154

Upk2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6692303 1.0 ug DNA
EUR 154

Upk2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6692304 1.0 ug DNA
EUR 154

Upk2 3'UTR GFP Stable Cell Line

TU171611 1.0 ml Ask for price

UPK2 3'UTR GFP Stable Cell Line

TU077868 1.0 ml
EUR 1394

Upk2 3'UTR Luciferase Stable Cell Line

TU121611 1.0 ml Ask for price

UPK2 3'UTR Luciferase Stable Cell Line

TU027868 1.0 ml
EUR 1394

Upk2 3'UTR Luciferase Stable Cell Line

TU222886 1.0 ml Ask for price

Upk2 3'UTR GFP Stable Cell Line

TU272886 1.0 ml Ask for price

UPK2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K2591905 3 x 1.0 ug
EUR 376

UPK2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV651097 1.0 ug DNA
EUR 514

UPK2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV651101 1.0 ug DNA
EUR 514

UPK2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV651102 1.0 ug DNA
EUR 514

UPK2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K2591906 1.0 ug DNA
EUR 167

UPK2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K2591907 1.0 ug DNA
EUR 167

UPK2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K2591908 1.0 ug DNA
EUR 167

Upk2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3928805 3 x 1.0 ug
EUR 376

Upk2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6692305 3 x 1.0 ug
EUR 376

Upk2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3928806 1.0 ug DNA
EUR 167

Upk2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3928807 1.0 ug DNA
EUR 167

Upk2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3928808 1.0 ug DNA
EUR 167

UPK2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV651098 1.0 ug DNA
EUR 514

UPK2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV651099 1.0 ug DNA
EUR 572

UPK2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV651100 1.0 ug DNA
EUR 572

Upk2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6692306 1.0 ug DNA
EUR 167

Upk2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6692307 1.0 ug DNA
EUR 167

Upk2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6692308 1.0 ug DNA
EUR 167

STAG3L1 Recombinant Protein (Human) (Recombinant Tag)

RP030283 100 ug Ask for price

STAG3L2 Recombinant Protein (Human) (Recombinant Tag)

RP030286 100 ug Ask for price

STAG3L3 Recombinant Protein (Human) (Recombinant Tag)

RP030289 100 ug Ask for price

STAG3L4 Recombinant Protein (Human) (Recombinant Tag)

RP030292 100 ug Ask for price

TAGAP Recombinant Protein (Human) (Recombinant- Tag)

RP030880 100 ug Ask for price

TAGLN Recombinant Protein (Human) (Recombinant- Tag)

RP030883 100 ug Ask for price

TAGLN Recombinant Protein (Human) (Recombinant- Tag)

RP030886 100 ug Ask for price

TAGLN2 Recombinant Protein (Human) (Recombinant Tag)

RP030889 100 ug Ask for price

TAGLN2 Recombinant Protein (Human) (Recombinant Tag)

RP030892 100 ug Ask for price

TAGLN3 Recombinant Protein (Human) (Recombinant Tag)

RP030895 100 ug Ask for price

CTAG1A Recombinant Protein (Human) (Recombinant- Tag)

RP038332 100 ug Ask for price

CTAG1B Recombinant Protein (Human) (Recombinant- Tag)

RP038335 100 ug Ask for price

CTAGE5 Recombinant Protein (Human) (Recombinant- Tag)

RP038338 100 ug Ask for price

TAGAP Recombinant Protein (Human) (Recombinant- Tag)

RP043930 100 ug Ask for price

CTAGE3P Recombinant Protein (Human) (Recombinant Tag)

RP053400 100 ug Ask for price

CTAGE4 Recombinant Protein (Human) (Recombinant- Tag)

RP053403 100 ug Ask for price

The BCs with excessive photo voltaic absorbance and super-hydrophilicity have been utilized within the photo-thermal purification of dye wastewater with photo voltaic power. The best evaporation fee of dye wastewater with BCs reached 2.27 kg m-2 h-1, and the corresponding conversion effectivity of photo voltaic to steam era was 78.98% underneath the simulated photo voltaic irradiation (1846.Zero w/m2). Contemplating the straightforward and economical preparation methodology, this course of made the sensible large-scale software of photo-thermal BCs on dye wastewater therapy a actuality, and in addition offered an cost-effective administration technique for the waste biomass.