Solar cell designs by maximizing energy production based on machine learning clustering of spectral variations.

Because of spectral sensitivity results, utilizing a single customary spectrum results in a big uncertainty when estimating the yearly averaged photovoltaic effectivity or vitality yield. Right here we reveal how machine studying methods can cut back the yearly spectral units by three orders of magnitude to units of some attribute spectra, and use the ensuing proxy spectra to search out the optimum photo voltaic cell designs maximizing the yearly vitality manufacturing. When utilizing customary circumstances, our calculated effectivity limits present good settlement with present photovoltaic effectivity information, however photo voltaic cells designed for report effectivity below the present customary spectra should not optimum for maximizing the yearly vitality yield.

Our outcomes present that greater than 1 MWh m-2 12 months-1 can realistically be obtained from superior multijunction techniques making use of the direct, diffuse, and back-side albedo elements of the irradiance. Natural bulk heterojunction photo voltaic cells typically endure from a trade-off between the open circuit voltage (Voc) and the brief circuit present density (Jsc) below a given donor/acceptor (D/A) interfacial energetic offset (or the so-called driving pressure). Right here we theoretically examine the optimum driving vitality required for attaining the balanced Jsc and Voc concurrently.

To this finish, the Jscversus the driving pressure ΔE curves are calculated below two totally different cost separation mechanisms by using the drift-diffusion technique. For the Marcus incoherent mechanism, the curve incorporates a excessive plateau in a broad vary of ΔE ranging from 0.2 eV, which is because of the accumulation of undissociated excitons inside their lifetime and signifies the opportunity of acquiring a large Jsc below a ΔE worth a lot smaller than the reorganization vitality. After incorporating each the electron and gap switch pathways into the machine mannequin, the calculated J-V curves are similar to experimentally measured ones foractual blended techniques of various driving forces.

For the coherent mechanism, it’s demonstrated that the utmost Jsc can be achieved below the ΔE of 0.2 eV if a big proportion of the high-lying delocalized states are harvested by tuning the density of states for the cost switch excitons to cut back the sub-gap states. This theoretical work revealed quantitatively the connection between the interfacial vitality offsets and machine efficiency, and in addition supplies some tips for figuring out the macroscopic options of the particular cost separation mechanisms in bulk heterojunction photo voltaic cells.

Photo voltaic pushed Stirling engine – chemical warmth pump – absorption fridge hybrid system as environmental pleasant vitality system.

Goal of this paper is to current another environmental pleasant vitality system consisting of photo voltaic pushed Stirling Engine, chemical warmth pump and absorption refrigeration system. Photo voltaic vitality is the principle vitality supply and waste warmth is rejected by the Stirling engine is utilized by the chemical warmth pump and absorption fridge. This technique presents another environmental pleasant vitality system that produces electrical energy, cooling and heating similar time. A parametric analysis is performed contemplating energy output, vitality effectivity and exergy destruction price. Outcomes are obtained numerically and mentioned.

Most energy output is 9.463 kW, most vitality effectivity of the hybrid system is 0.337. Evaluating these outcomes with Stirling engine, most energy output of the hybrid system will increase 14% and vitality effectivity will increase 13% for the hybrid system. Modeling the spatial and temporal dynamics of soil temperature is deterministically complicated because of the huge variability of a number of influential environmental variables, together with soil column composition, soil moisture, air temperature, and photo voltaic vitality. Panorama incident photo voltaic radiation is a big environmental driver that impacts each air temperature and ground-level soil vitality loading; subsequently, inclusion of photo voltaic vitality is essential for producing correct representations of soil temperature.

We used the U.S. Environmental Safety Company’s Oregon Crest-to-Coast Environmental Monitoring Transect dataset to develop and check the inclusion of ground-level photo voltaic vitality driver information inside an current soil temperature mannequin at present utilized inside an ecohydrology mannequin referred to as Visualizing Ecosystem Land Administration Assessments. The O’CCMoN website information elucidate how localized ground-level photo voltaic vitality between open and forested landscapes vastly affect the ensuing soil temperature.

We reveal how the inclusion of native ground-level photo voltaic vitality considerably improves the power to deterministically mannequin soil temperature at two depths. These outcomes recommend that panorama and watershed-scale fashions ought to incorporate spatially distributed photo voltaic vitality to enhance spatial and temporal simulations of soil temperature. In response to the outcomes, system operates most effectively on the excessive temperature ratio of the working fluids of the Stirling engine and excessive collector floor temperature.

 

Impact of the Electron Transport Layer on the Interfacial Power Obstacles and Lifetime of R2R Printed Natural Photo voltaic Cell Modules.

Understanding the phenomena at interfaces is essential for producing environment friendly and steady versatile natural photo voltaic cell modules. Minimized vitality boundaries allow environment friendly cost switch, and good adhesion permits mechanical and environmental stability and thus elevated lifetime. We make the most of right here the inverted natural photo voltaic module stack and customary photoactive supplies (a mix of poly(3-hexylthiophene) and [6,6]-phenyl C61 butyric acid methyl ester) to review the interfaces in a pilot scale large-area roll-to-roll (R2R) course of.

Mouse Angiopoietin Like Protein 2 (ANGPTL2) Protein
20-abx065332
  • EUR 676.00
  • EUR 286.00
  • EUR 2082.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
anti-Angiopoietin like 7
LF-PA10021 50 ug
EUR 363
Description: Mouse polyclonal to Angiopoietin like 7
Mouse Angiopoietin Like Protein 2 ELISA kit
E03A0505-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Angiopoietin Like Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Angiopoietin Like Protein 2 ELISA kit
E03A0505-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Angiopoietin Like Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Angiopoietin Like Protein 2 ELISA kit
E03A0505-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Angiopoietin Like Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Anti-Angiopoietin-like 4 Antibody
STJ500081 100 µg
EUR 476
Angiopoietin Like Protein 2 (ANGPTL2) Antibody
20-abx175386
  • EUR 1177.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.
Angiopoietin Like Protein 2 (ANGPTL2) Antibody
20-abx211819
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Angiopoietin Like Protein 2 (ANGPTL2) Antibody
20-abx103089
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.
Angiopoietin Like Protein 2 (ANGPTL2) Antibody
20-abx103090
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Angiopoietin Like Protein 2 (ANGPTL2) Antibody
20-abx103091
  • EUR 439.00
  • EUR 133.00
  • EUR 1247.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.
Angiopoietin Like Protein 2 (ANGPTL2) Antibody
20-abx110975
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Angiopoietin Like Protein 2 (ANGPTL2) Antibody
20-abx130201
  • EUR 439.00
  • EUR 133.00
  • EUR 1247.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Angiopoietin Like Protein 2 (ANGPTL2) Antibody
20-abx171222
  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.
Angiopoietin Like Protein 2 (ANGPTL2) Antibody
20-abx318439
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Angiopoietin Like Protein 2 (ANGPTL2) Antibody
20-abx301744
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Angiopoietin Like Protein 2 (ANGPTL2) Antibody
abx230397-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Recombinant Angiopoietin Like Protein 2 (ANGPTL2)
4-RPB919Hu01
  • EUR 440.48
  • EUR 221.00
  • EUR 1376.80
  • EUR 525.60
  • EUR 951.20
  • EUR 358.00
  • EUR 3292.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9UKU9
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 28.0kDa
  • Isoelectric Point: 7.3
Description: Recombinant Human Angiopoietin Like Protein 2 expressed in: E.coli
Recombinant Angiopoietin Like Protein 2 (ANGPTL2)
4-RPB919Mu01
  • EUR 485.28
  • EUR 233.00
  • EUR 1544.80
  • EUR 581.60
  • EUR 1063.20
  • EUR 388.00
  • EUR 3712.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9R045
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 30.5kDa
  • Isoelectric Point: 8.6
Description: Recombinant Mouse Angiopoietin Like Protein 2 expressed in: E.coli
Recombinant Angiopoietin Like Protein 2 (ANGPTL2)
4-RPB919Ra01
  • EUR 535.46
  • EUR 246.00
  • EUR 1732.96
  • EUR 644.32
  • EUR 1188.64
  • EUR 421.00
  • EUR 4182.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9JJ03
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 20.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Angiopoietin Like Protein 2 expressed in: E.coli
Recombinant Angiopoietin Like Protein 2 (ANGPTL2)
4-RPB919Ra02
  • EUR 535.46
  • EUR 246.00
  • EUR 1732.96
  • EUR 644.32
  • EUR 1188.64
  • EUR 421.00
  • EUR 4182.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9JJ03
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 20.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Angiopoietin Like Protein 2 expressed in: E.coli
ANGPTL3 (243-460) Angiopoietin-like Protein 3 (243-460 a.a.) Human Recombinant Protein
PROTQ9Y5C1-2 Regular: 20ug
EUR 317
Description: ANGPTL3 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 239 amino acids (243-460 a.a) and having a molecular mass of 27.7kDa. ANGPTL3 is fused to a 21 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.
Mouse Angiopoietin Like Protein 2 (ANGPTL2) ELISA Kit
DLR-ANGPTL2-Mu-48T 48T
EUR 508
  • Should the Mouse Angiopoietin Like Protein 2 (ANGPTL2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Angiopoietin Like Protein 2 (ANGPTL2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Mouse Angiopoietin Like Protein 2 (ANGPTL2) ELISA Kit
DLR-ANGPTL2-Mu-96T 96T
EUR 661
  • Should the Mouse Angiopoietin Like Protein 2 (ANGPTL2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Angiopoietin Like Protein 2 (ANGPTL2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Mouse Angiopoietin Like Protein 2 (ANGPTL2) CLIA Kit
abx195202-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Mouse Angiopoietin Like Protein 2 (ANGPTL2) ELISA Kit
20-abx153639
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Mouse Angiopoietin Like Protein 2 (ANGPTL2) ELISA Kit
abx255181-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.
Mouse Angiopoietin Like Protein 2 (ANGPTL2) ELISA Kit
abx575925-96tests 96 tests
EUR 833
  • Shipped within 5-12 working days.
Mouse Angiopoietin Like Protein 2 (ANGPTL2) ELISA Kit
abx518830-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.
Mouse Angiopoietin Like Protein 2 (ANGPTL2) CLIA Kit
20-abx493252
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Mouse ANGPTL2(Angiopoietin Like Protein 2) ELISA Kit
EM0835 96T
EUR 524.1
  • Detection range: 31.25-2000 pg/ml
  • Uniprot ID: Q9R045
  • Alias: ANGPTL2/ANGRP2/angiopoietin-like 2/Angiopoietin-like protein 2/angiopoietin-related protein 2/ARP2HARP/
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 18.75pg/ml
Mouse Angiopoietin Like Protein 2 (ANGPTL2) ELISA Kit
RDR-ANGPTL2-Mu-48Tests 48 Tests
EUR 534
Mouse Angiopoietin Like Protein 2 (ANGPTL2) ELISA Kit
RDR-ANGPTL2-Mu-96Tests 96 Tests
EUR 742
Mouse Angiopoietin Like Protein 2 (ANGPTL2) ELISA Kit
SEB919Mu-10x96wellstestplate 10x96-wells test plate
EUR 4626.78
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Angiopoietin Like Protein 2 (ANGPTL2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Angiopoietin Like Protein 2 (ANGPTL2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Mouse Angiopoietin Like Protein 2 (ANGPTL2) ELISA Kit
SEB919Mu-1x48wellstestplate 1x48-wells test plate
EUR 468.68
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Angiopoietin Like Protein 2 (ANGPTL2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Angiopoietin Like Protein 2 (ANGPTL2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Mouse Angiopoietin Like Protein 2 (ANGPTL2) ELISA Kit
SEB919Mu-1x96wellstestplate 1x96-wells test plate
EUR 626.68
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Angiopoietin Like Protein 2 (ANGPTL2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Angiopoietin Like Protein 2 (ANGPTL2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Mouse Angiopoietin Like Protein 2 (ANGPTL2) ELISA Kit
SEB919Mu-5x96wellstestplate 5x96-wells test plate
EUR 2520.06
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Angiopoietin Like Protein 2 (ANGPTL2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Angiopoietin Like Protein 2 (ANGPTL2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Mouse Angiopoietin Like Protein 2 (ANGPTL2) ELISA Kit
4-SEB919Mu
  • EUR 4677.00
  • EUR 2471.00
  • EUR 627.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Angiopoietin Like Protein 2 elisa. Alternative names of the recognized antigen: HARP
  • ARP2
  • Angiopoietin-Related Protein 2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Angiopoietin Like Protein 2 (ANGPTL2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.
Mouse Angiopoietin Like Protein 2 ELISA Kit (ANGPTL2)
RK02595 96 Tests
EUR 521
Mouse Angiopoietin Like Protein 2 (ANGPTL2) ELISA Kit
RD-ANGPTL2-Mu-48Tests 48 Tests
EUR 511
Mouse Angiopoietin Like Protein 2 (ANGPTL2) ELISA Kit
RD-ANGPTL2-Mu-96Tests 96 Tests
EUR 709
Human Angiopoietin Like Protein 2 (ANGPTL2) Protein
20-abx065329
  • EUR 620.00
  • EUR 272.00
  • EUR 1859.00
  • EUR 732.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Rat Angiopoietin Like Protein 2 (ANGPTL2) Protein
20-abx065330
  • EUR 746.00
  • EUR 300.00
  • EUR 2332.00
  • EUR 885.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Rat Angiopoietin Like Protein 2 (ANGPTL2) Protein
20-abx065331
  • EUR 746.00
  • EUR 300.00
  • EUR 2332.00
  • EUR 885.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.
Anti-Visinin-like Protein 1 Antibody
M06959-2 100ul
EUR 397
Description: Rabbit Polyclonal Visinin-like Protein 1 Antibody. Validated in IF, IHC, WB and tested in Human, Mouse, Rat.
Mouse Angiopoietin-like protein 8 (Angptl8)
1-CSB-EP844436MO
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 24.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Angiopoietin-like protein 8(Angptl8) expressed in E.coli
Mouse Angiopoietin-like protein 8 (Angptl8)
1-CSB-YP844436MO
  • EUR 504.00
  • EUR 265.00
  • EUR 1832.00
  • EUR 763.00
  • EUR 1216.00
  • EUR 334.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 22.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Angiopoietin-like protein 8(Angptl8) expressed in Yeast
Anti-Angiopoietin-2 Antibody
A1291-100
EUR 370
anti- Angiopoietin 2 antibody
FNab00392 100µg
EUR 585
  • Recommended dilution: WB: 1:500-1:5000
  • IHC: 1:20-1:200
  • IP: 1:200-1:2000
  • Immunogen: angiopoietin 2
  • Uniprot ID: O15123
  • Research Area: Immunology, Cardiovascular, Developmental biology, Signal Transduction
Description: Antibody raised against Angiopoietin 2
Anti-Angiopoietin 2 antibody
PAab00392 100 ug
EUR 412
CLIA kit for Mouse ANGPTL2 (Angiopoietin Like Protein 2)
E-CL-M0079 1 plate of 96 wells
EUR 584
  • Gentaur's ANGPTL2 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Mouse ANGPTL2 . Standards or samples are added to the micro CLIA plate wells and combined wit
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Mouse ANGPTL2 (Angiopoietin Like Protein 2) in samples from Serum, Plasma, Cell supernatant
ELISA kit for Mouse ANGPTL2 (Angiopoietin Like Protein 2)
E-EL-M0092 1 plate of 96 wells
EUR 534
  • Gentaur's ANGPTL2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse ANGPTL2. Standards or samples are added to the micro ELISA plate wells and combined w
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse ANGPTL2 (Angiopoietin Like Protein 2) in samples from Serum, Plasma, Cell supernatant
ELISA kit for Mouse ANGPTL2 (Angiopoietin Like Protein 2)
ELK3189 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Angiopoietin Like Protein 2 (ANGPTL2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific
  • Show more
Description: A sandwich ELISA kit for detection of Angiopoietin Like Protein 2 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Angiopoietin Like Protein 2 (ANGPTL2) Polyclonal Antibody (Mouse, Rat)
4-PAB919Mu01
  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ANGPTL2 (Ser267~His493)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Angiopoietin Like Protein 2 (ANGPTL2)
Rabbit Angiopoietin Like Protein 2 ELISA kit
E04A0505-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Angiopoietin Like Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Angiopoietin Like Protein 2 ELISA kit
E04A0505-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Angiopoietin Like Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Angiopoietin Like Protein 2 ELISA kit
E04A0505-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Angiopoietin Like Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Angiopoietin Like Protein 2 ELISA kit
E02A0505-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Angiopoietin Like Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Angiopoietin Like Protein 2 ELISA kit
E02A0505-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Angiopoietin Like Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Angiopoietin Like Protein 2 ELISA kit
E02A0505-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Angiopoietin Like Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Angiopoietin Like Protein 2 ELISA kit
E06A0505-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Angiopoietin Like Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Angiopoietin Like Protein 2 ELISA kit
E06A0505-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Angiopoietin Like Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Angiopoietin Like Protein 2 ELISA kit
E06A0505-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Angiopoietin Like Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Angiopoietin Like Protein 2 ELISA kit
E01A0505-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Angiopoietin Like Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Angiopoietin Like Protein 2 ELISA kit
E01A0505-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Angiopoietin Like Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Angiopoietin Like Protein 2 ELISA kit
E01A0505-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Angiopoietin Like Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Angiopoietin Like Protein 2 ELISA kit
E09A0505-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Angiopoietin Like Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Angiopoietin Like Protein 2 ELISA kit
E09A0505-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Angiopoietin Like Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Angiopoietin Like Protein 2 ELISA kit
E09A0505-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Angiopoietin Like Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Angiopoietin Like Protein 2 ELISA kit
E08A0505-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Angiopoietin Like Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Angiopoietin Like Protein 2 ELISA kit
E08A0505-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Angiopoietin Like Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Angiopoietin Like Protein 2 ELISA kit
E08A0505-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Angiopoietin Like Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Angiopoietin Like Protein 2 ELISA kit
E07A0505-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Angiopoietin Like Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Angiopoietin Like Protein 2 ELISA kit
E07A0505-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Angiopoietin Like Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Angiopoietin Like Protein 2 ELISA kit
E07A0505-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Angiopoietin Like Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Angiopoietin Like Protein 2 (ANGPTL2) Antibody (Biotin)
20-abx272211
  • EUR 439.00
  • EUR 244.00
  • EUR 1261.00
  • EUR 606.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.
Angiopoietin Like Protein 2 (ANGPTL2) Antibody (Biotin)
20-abx273366
  • EUR 467.00
  • EUR 244.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Angiopoietin Like Protein 2 (ANGPTL2) Antibody (HRP)
20-abx312179
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Angiopoietin Like Protein 2 (ANGPTL2) Antibody (FITC)
20-abx312180
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Angiopoietin Like Protein 2 (ANGPTL2) Antibody (Biotin)
20-abx312181
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Angiopoietin Like Protein 2 (ANGPTL2) Antibody (HRP)
20-abx312182
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Angiopoietin Like Protein 2 (ANGPTL2) Antibody (FITC)
20-abx312183
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Angiopoietin Like Protein 2 (ANGPTL2) Antibody (Biotin)
20-abx312184
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Anti-ANGPTL7/Angiopoietin Like 7 Antibody
A11067 100ul
EUR 397
Description: Rabbit Polyclonal ANGPTL7/Angiopoietin Like 7 Antibody. Validated in WB and tested in Human.
Anti-Angptl7/Angiopoietin Like 7 Antibody
A11067-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for Angptl7 Antibody (ANGPTL7) detection.tested for WB in Human, Mouse.
Anti-Angiopoietin-like 4?/ANGPTL4 Antibody
A01147 100ug/vial
EUR 294
Anti-Angiopoietin-like 4/ANGPTL4 Antibody
PA1435 100ug/vial
EUR 294
Anti-Angiopoietin-like 4 Antibody BIOTIN
STJ500082 100 µg
EUR 586
Anti-Angiopoietin-like 4 Antibody FITC
STJ500083 100 µg
EUR 586
Rabbit Polyclonal antibody Anti-CRBN
Anti-CRBN 50 µg
EUR 349
Mouse Angiopoietin Like Protein 3 (ANGPTL3) Protein
20-abx165986
  • EUR 704.00
  • EUR 286.00
  • EUR 2193.00
  • EUR 843.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Mouse Angiopoietin Like Protein 8 (ANGPTL8) Protein
20-abx165988
  • EUR 718.00
  • EUR 286.00
  • EUR 2249.00
  • EUR 857.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Mouse Angiopoietin Like Protein 1 (ANGPTL1) Protein
20-abx065326
  • EUR 732.00
  • EUR 286.00
  • EUR 2305.00
  • EUR 885.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Mouse Angiopoietin Like Protein 3 (ANGPTL3) Protein
20-abx065335
  • EUR 704.00
  • EUR 286.00
  • EUR 2193.00
  • EUR 843.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.
Mouse Angiopoietin Like Protein 4 (ANGPTL4) Protein
20-abx065337
  • EUR 620.00
  • EUR 272.00
  • EUR 1859.00
  • EUR 732.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Mouse Angiopoietin Like Protein 6 (ANGPTL6) Protein
20-abx065341
  • EUR 746.00
  • EUR 300.00
  • EUR 2346.00
  • EUR 899.00
  • EUR 537.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.
Mouse Angiopoietin Like Protein 7 (ANGPTL7) Protein
20-abx065342
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.
Angiopoietin-like Protein 6 Protein
20-abx262419
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.
Angiopoietin-like Protein 3 Protein
20-abx262980
  • EUR 328.00
  • EUR 6675.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.
Angiopoietin-like Protein 4 Protein
20-abx262981
  • EUR 328.00
  • EUR 6675.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.
ANGPTL2 Angiopoietin-like Protein 2 Human Recombinant Protein
PROTQ9UKU9 Regular: 10ug
EUR 317
Description: ANGPTL2 Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 481 amino acids including a 10 a.a N-terminal His tag. The total molecular mass is 56kDa (calculated).
Mouse Angiopoietin Like Protein 1 ELISA kit
E03A0504-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Angiopoietin Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Angiopoietin Like Protein 1 ELISA kit
E03A0504-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Angiopoietin Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Angiopoietin Like Protein 1 ELISA kit
E03A0504-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Angiopoietin Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Angiopoietin Like Protein 3 ELISA kit
E03A0506-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Angiopoietin Like Protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Angiopoietin Like Protein 3 ELISA kit
E03A0506-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Angiopoietin Like Protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Angiopoietin Like Protein 3 ELISA kit
E03A0506-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Angiopoietin Like Protein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Angiopoietin Like Protein 4 ELISA kit
E03A0507-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Angiopoietin Like Protein 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Angiopoietin Like Protein 4 ELISA kit
E03A0507-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Angiopoietin Like Protein 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Angiopoietin Like Protein 4 ELISA kit
E03A0507-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Angiopoietin Like Protein 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Angiopoietin 2 (ANGPT2) Protein
20-abx065319
  • EUR 620.00
  • EUR 272.00
  • EUR 1859.00
  • EUR 732.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.
ANGPTL2 ELISA Kit| Mouse Angiopoietin Like Protein 2 ELISA Kit
EF013440 96 Tests
EUR 689
Angiopoietin Like Protein 2 (ANGPTL2) Polyclonal Antibody (Mouse, Rat), APC
4-PAB919Mu01-APC
  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ANGPTL2 (Ser267~His493)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Angiopoietin Like Protein 2 (ANGPTL2). This antibody is labeled with APC.
Angiopoietin Like Protein 2 (ANGPTL2) Polyclonal Antibody (Mouse, Rat), Biotinylated
4-PAB919Mu01-Biotin
  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ANGPTL2 (Ser267~His493)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Angiopoietin Like Protein 2 (ANGPTL2). This antibody is labeled with Biotin.
Angiopoietin Like Protein 2 (ANGPTL2) Polyclonal Antibody (Mouse, Rat), Cy3
4-PAB919Mu01-Cy3
  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ANGPTL2 (Ser267~His493)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Angiopoietin Like Protein 2 (ANGPTL2). This antibody is labeled with Cy3.
Angiopoietin Like Protein 2 (ANGPTL2) Polyclonal Antibody (Mouse, Rat), FITC
4-PAB919Mu01-FITC
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ANGPTL2 (Ser267~His493)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Angiopoietin Like Protein 2 (ANGPTL2). This antibody is labeled with FITC.
Angiopoietin Like Protein 2 (ANGPTL2) Polyclonal Antibody (Mouse, Rat), HRP
4-PAB919Mu01-HRP
  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ANGPTL2 (Ser267~His493)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Angiopoietin Like Protein 2 (ANGPTL2). This antibody is labeled with HRP.
Angiopoietin Like Protein 2 (ANGPTL2) Polyclonal Antibody (Mouse, Rat), PE
4-PAB919Mu01-PE
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ANGPTL2 (Ser267~His493)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Angiopoietin Like Protein 2 (ANGPTL2). This antibody is labeled with PE.
Angiopoietin 2 protein
30R-3254 50 ug
EUR 257
Description: Purified recombinant Angiopoietin 2 protein
Angiopoietin 2 protein
30R-AA032 20 ug
EUR 483
Description: Purified recombinant Human Angiopoietin 2 protein
Human Angiopoietin-like protein 2,ANGPTL2 ELISA Kit
201-12-1270 96 tests
EUR 440
  • This Angiopoietin-like protein 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Angiopoietin Like Protein 2 (ANGPTL2) ELISA Kit
DLR-ANGPTL2-Hu-48T 48T
EUR 498
  • Should the Human Angiopoietin Like Protein 2 (ANGPTL2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Angiopoietin Like Protein 2 (ANGPTL2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human Angiopoietin Like Protein 2 (ANGPTL2) ELISA Kit
DLR-ANGPTL2-Hu-96T 96T
EUR 647
  • Should the Human Angiopoietin Like Protein 2 (ANGPTL2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Angiopoietin Like Protein 2 (ANGPTL2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Rat Angiopoietin Like Protein 2 (ANGPTL2) ELISA Kit
DLR-ANGPTL2-Ra-48T 48T
EUR 528
  • Should the Rat Angiopoietin Like Protein 2 (ANGPTL2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Angiopoietin Like Protein 2 (ANGPTL2) in samples from serum, plasma, tissue homogenates or other biological fluids.
Rat Angiopoietin Like Protein 2 (ANGPTL2) ELISA Kit
DLR-ANGPTL2-Ra-96T 96T
EUR 690
  • Should the Rat Angiopoietin Like Protein 2 (ANGPTL2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Angiopoietin Like Protein 2 (ANGPTL2) in samples from serum, plasma, tissue homogenates or other biological fluids.
Guinea pig Angiopoietin Like Protein 2 ELISA kit
E05A0505-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Angiopoietin Like Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Guinea pig Angiopoietin Like Protein 2 ELISA kit
E05A0505-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Angiopoietin Like Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Guinea pig Angiopoietin Like Protein 2 ELISA kit
E05A0505-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Angiopoietin Like Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Angiopoietin Like Protein 2 (ANGPTL2) CLIA Kit
abx195201-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Human Angiopoietin Like Protein 2 (ANGPTL2) ELISA Kit
20-abx150658
  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Rat Angiopoietin Like Protein 2 (ANGPTL2) ELISA Kit
20-abx155200
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Angiopoietin Like Protein 2 (ANGPTL2) ELISA Kit
abx251324-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human angiopoietin-like protein 2(ANGPTL2) ELISA kit
CSB-E13881h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human angiopoietin-like protein 2 (ANGPTL2) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human angiopoietin-like protein 2(ANGPTL2) ELISA kit
1-CSB-E13881h
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human angiopoietin-like protein 2(ANGPTL2) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Monkey Angiopoietin Like Protein 2 (ANGPTL2) ELISA Kit
abx359460-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Pig Angiopoietin Like Protein 2 (ANGPTL2) ELISA Kit
abx361233-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Rabbit Angiopoietin Like Protein 2 (ANGPTL2) ELISA Kit
abx363130-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Chicken Angiopoietin Like Protein 2 (ANGPTL2) ELISA Kit
abx356056-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Human Angiopoietin Like Protein 2 (ANGPTL2) ELISA Kit
abx572241-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human Angiopoietin Like Protein 2 (ANGPTL2) CLIA Kit
20-abx493251
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Rat Angiopoietin Like Protein 2 (ANGPTL2) CLIA Kit
20-abx493253
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Human Angiopoietin-like protein 2(ANGPTL2)ELISA Kit
GA-E1286HM-48T 48T
EUR 289
Human Angiopoietin-like protein 2(ANGPTL2)ELISA Kit
GA-E1286HM-96T 96T
EUR 466
Angiopoietin Like Protein 2 (ANGPTL2) Polyclonal Antibody (Human)
4-PAB919Hu01
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ANGPTL2 (Ser267~His493)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Angiopoietin Like Protein 2 (ANGPTL2)
Angiopoietin Like Protein 2 (ANGPTL2) Polyclonal Antibody (Rat)
4-PAB919Ra01
  • EUR 251.00
  • EUR 2589.00
  • EUR 643.00
  • EUR 317.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ANGPTL2 (Ala47~Val207)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Angiopoietin Like Protein 2 (ANGPTL2)
Angiopoietin Like Protein 2 (ANGPTL2) Polyclonal Antibody (Rat)
4-PAB919Ra02
  • EUR 251.00
  • EUR 2589.00
  • EUR 643.00
  • EUR 317.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ANGPTL2 (Leu141~Asp308)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Angiopoietin Like Protein 2 (ANGPTL2)

The outcomes present that the adhesion and work perform of the zinc oxide nanoparticle based mostly electron transport layer may be managed within the R2R course of, which permits optimization of efficiency and lifelong. Plasma remedy of zinc oxide (ZnO) nanoparticles and encapsulation-induced oxygen trapping will improve absolutely the worth of the ZnO work perform, leading to vitality boundaries and an S-shaped IV curve. Nevertheless, gentle soaking will lower the zinc oxide work perform near the unique worth and the S-shape may be recovered, resulting in energy conversion efficiencies above 3%. We current additionally {an electrical} simulation, which helps the outcomes.

Magnetically Driven 3D Cellulose Film for Improved Energy Efficiency in Solar Evaporation

Magnetically Driven 3D Cellulose Film for Improved Energy Efficiency in Solar Evaporation

The structure of cellulose nanomaterials is definitized by random deposition and can’t change in response to shifting software necessities. Herein, we current a magnetic field-controlled cellulose movie derived from wooden that reveals nice magnetic properties and dependable tunability enabled by included Fe3O4 nanoparticles and cellulose nanofibers (CNF) with a big length-diameter ratio. Fe3O4 nanoparticles are dispersed in suspensions of CNF in order to boost the magnetic response. The airplane magnetic CNF might be processed to type a three-dimensional (3D) flower-like construction alongside the magnetic induction line after making use of an exterior magnet.

Impressed by the fluidic transport in pure flowers, a bilayer construction was created utilizing the 3D flower-like movie because the photo voltaic power receiver and pure wooden because the water pathway in a solar-derived evaporation system. In contrast with a planar cellulose movie embellished with Fe3O4, the 3D construction design can drastically enhance the evaporation fee from 1.19 to 1.39 kg m-2 h-1 and the effectivity from 76.9 to 90.6% underneath 1 solar. Finite component molding additional reveals that the 3D structural prime layer is useful for the formation of a gradient temperature profile and the advance of the power effectivity via the discount of thermal radiation.

The magnetically managed fabrication represents a promising technique for designing cellulose nanomaterials with an advanced construction and controllable topography, which has a large spectrum of purposes in power storage units and water therapy. Though the transition to renewable energies will intensify the worldwide competitors for land, the potential impacts pushed by photo voltaic power stay unexplored. On this work, the potential photo voltaic land necessities and associated land use change emissions are computed for the EU, India, Japan and South Korea. A novel methodology is developed inside an built-in evaluation mannequin which hyperlinks socioeconomic, power, land and local weather techniques.

At 25-80% penetration within the electrical energy mixture of these areas by 2050, we discover that photo voltaic power could occupy 0.5-5% of whole land. The ensuing land cowl adjustments, together with oblique results, will probably trigger a internet launch of carbon starting from Zero to 50 gCO2/kWh, relying on the area, scale of enlargement, photo voltaic expertise effectivity and land administration practices in photo voltaic parks. Therefore, a coordinated planning and regulation of latest photo voltaic power infrastructures must be enforced to keep away from a big improve of their life cycle emissions via terrestrial carbon losses.

Shadow enhanced self-charging energy system for wave and photo voltaic power harvesting from the ocean

Hybrid energy-harvesting techniques that seize each wave and photo voltaic power from the oceans utilizing triboelectric nanogenerators and photovoltaic cells are promising renewable power options. Nonetheless, ubiquitous shadows forged from transferring objects in these techniques are undesirable as they degrade the efficiency of the photovoltaic cells. Right here we report a shadow-tribo-effect nanogenerator that hybrids tribo-effect and shadow-effect collectively to beat this problem. A number of fiber-supercapacitors are built-in with the shadow-tribo-effect nanogenerator to type a self-charging energy system. To seize and retailer wave/photo voltaic power from oceans, an power ball based mostly on the self-charging energy system is demonstrated.

By harnessing the shadow-effect, i.e. the shadow of the transferring object within the power ball, the charging time shortens to 253.Three s to cost the fiber-supercapacitors to the identical voltage (0.Three V) as utilizing pure tribo-effect. This cost-effective methodology to reap and retailer the wave/photo voltaic power from the oceans on this work is anticipated to encourage next-generation large-scale blue power harvesting.  With the depletion of fossil power, photo voltaic power has steadily attracted folks’s consideration.

Dye-sensitized photo voltaic cells have developed quickly in recent times as a result of their low value and excessive conversion effectivity. On this article, based mostly on the theoretical analysis on the photovoltaic parameters of DSSCs within the early levels of the analysis workforce, we’ve got made an correct prediction of J scV oc, and PCE of C286. (The error in our predicted PCE values was 3.33% relative to the experiment.) Additionally, we additional designed a sequence of latest dyes CH1-CH5 by introducing donors and co-acceptors with C286-C288 because the prototype utilizing the DFT/TDDFT methodology.

The PCE of the designed dyes CH2-CH5 exceed the given dye C286, particularly the CH3 and CH4 obtained the PCE of 26.2 and 14.5%. This means the proposed dyes supply a dramatic enchancment on PCE for DSSC units. Furthermore, the designed dyes corresponding to CH3 and CH4 have nice potential to be utilized to photovoltaic purposes, additional enabling the design of novel, extremely environment friendly photoactive supplies. The collected clear water from the solar-steam evaporators reached the emission requirements of EU Water Framework Directive (91/271/EEC).

Magnetically Driven 3D Cellulose Film for Improved Energy Efficiency in Solar Evaporation

Value-effective useful resource utilization for waste biomass: A easy preparation methodology of photo-thermal biochar muffins (BCs) towards dye wastewater therapy with photo voltaic power

Waste biomass and dye wastewater pollutions have been the intense environmental issues. The interfacial solar-steam era expertise is an efficient and sustainable methodology for the water purification. Nonetheless, the advanced preparation course of, excessive financial value and doubtless secondary environmental air pollution of conventional photo-thermal supplies restricted their sensible large-scale software. Herein, the biochar muffins (BCs) deriving from waste biomass have been ready, and the granular and schistose MgO coatings have been dressed on the floor of carbonized fiber to enhance their hydrophilicity.

UPK2 Uroplakin 2 Human Recombinant Protein

PROTO00526 Regular: 20ug
EUR 317
Description: UPK2 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 153 amino acids (26-155 a.a) and having a molecular mass of 16.2kDa.;UPK2 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Recombinant Human UPK2 Protein, His, E.coli-1mg

QP13897-1mg 1mg
EUR 2757

Recombinant Human UPK2 Protein, His, E.coli-20ug

QP13897-20ug 20ug
EUR 201

Recombinant Human UPK2 Protein, His, E.coli-5ug

QP13897-5ug 5ug
EUR 155

Recombinant Uroplakin 2 (UPK2)

4-RPF561Hu01
  • EUR 368.80
  • EUR 202.00
  • EUR 1108.00
  • EUR 436.00
  • EUR 772.00
  • EUR 310.00
  • EUR 2620.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O00526
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 17.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Uroplakin 2 expressed in: E.coli

Human Uroplakin 2 (UPK2) Protein

20-abx650668
  • EUR 523.00
  • EUR 244.00
  • EUR 1497.00
  • EUR 606.00
  • EUR 384.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

UPK2 siRNA

20-abx939075
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

UPK2 antibody

70R-21174 50 ul
EUR 435
Description: Rabbit polyclonal UPK2 antibody

UPK2 Antibody

1-CSB-PA025656GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against UPK2. Recognizes UPK2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Uroplakin-2 (UPK2) Protein

20-abx261408
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

UPK2 protein (His tag)

30R-2967 100 ug
EUR 322
Description: Purified recombinant Human UPK2 protein (His tag)

Recombinant Human Uroplakin-2/UPK2 (C-6His)

CA11-10ug 10ug
EUR 202
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Recombinant Human Uroplakin-2/UPK2 (C-6His)

CA11-1mg 1mg
EUR 2283
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Recombinant Human Uroplakin-2/UPK2 (C-6His)

CA11-500ug 500ug
EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Recombinant Human Uroplakin-2/UPK2 (C-6His)

CA11-50ug 50ug
EUR 496
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

UPK2 ELISA KIT|Human

EF004088 96 Tests
EUR 689

Human UPK2 shRNA Plasmid

20-abx955048
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

UPK2 cloning plasmid

CSB-CL025656HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 555
  • Sequence: ATGGCACCCCTGCTGCCCATCCGGACCTTGCCCTTGATCCTGATTCTGCTGGCTCTGCTGTCCCCAGGGGCTGCAGACTTCAACATCTCAAGCCTCTCTGGTCTGCTGTCCCCGGCACTAACGGAGAGCCTGCTGGTTGCCTTGCCCCCCTGTCACCTCACAGGAGGCAATGCCAC
  • Show more
Description: A cloning plasmid for the UPK2 gene.

anti- UPK2 antibody

FNab09274 100µg
EUR 548.75
  • Recommended dilution: WB: 1:200-1:2000
  • IHC:1:20-1:200
  • Immunogen: uroplakin 2
  • Uniprot ID: O00526
  • Gene ID: 7379
  • Research Area: Developmental biology
Description: Antibody raised against UPK2

anti- UPK2 antibody

FNab09275 100µg
EUR 585
  • Recommended dilution: IHC:1:20-1:200
  • Immunogen: uroplakin 2
  • Uniprot ID: O00526
  • Gene ID: 7379
  • Research Area: Developmental biology
Description: Antibody raised against UPK2

UPK2 Rabbit pAb

A10813-100ul 100 ul
EUR 308

UPK2 Rabbit pAb

A10813-200ul 200 ul
EUR 459

UPK2 Rabbit pAb

A10813-20ul 20 ul
EUR 183

UPK2 Rabbit pAb

A10813-50ul 50 ul
EUR 223

UPK2 Rabbit pAb

A3338-100ul 100 ul
EUR 308

UPK2 Rabbit pAb

A3338-200ul 200 ul
EUR 459

UPK2 Rabbit pAb

A3338-20ul 20 ul Ask for price

UPK2 Rabbit pAb

A3338-50ul 50 ul Ask for price

UPK2 Polyclonal Antibody

27504-100ul 100ul
EUR 252

UPK2 Polyclonal Antibody

27504-50ul 50ul
EUR 187

Anti-UPK2 antibody

PAab09274 100 ug
EUR 386

Anti-UPK2 antibody

STJ26047 100 µl
EUR 277
Description: This gene encodes one of the proteins of the highly conserved urothelium-specific integral membrane proteins of the asymmetric unit membrane which forms urothelium apical plaques in mammals. The asymmetric unit membrane is believed to strengthen the urothelium by preventing cell rupture during bladder distention. The encoded protein is expressed in the peripheral blood of bladder cancer patients with transitional cell carcinomas.

Anti-UPK2 antibody

STJ112709 100 µl
EUR 277
Description: This gene encodes one of the proteins of the highly conserved urothelium-specific integral membrane proteins of the asymmetric unit membrane which forms urothelium apical plaques in mammals. The asymmetric unit membrane is believed to strengthen the urothelium by preventing cell rupture during bladder distention. The encoded protein is expressed in the peripheral blood of bladder cancer patients with transitional cell carcinomas.

UPK2 ORF Vector (Human) (pORF)

ORF014895 1.0 ug DNA
EUR 354

UPK2 ELISA Kit (Human) (OKCD00470)

OKCD00470 96 Wells
EUR 831
Description: Description of target: Component of the asymmetric unit membrane (AUM); a highly specialized biomembrane elaborated by terminally differentiated urothelial cells. May play an important role in regulating the assembly of the AUM (By similarity).By similarity ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.053 ng/mL

UPK2 ELISA Kit (Human) (OKAN06386)

OKAN06386 96 Wells
EUR 792
Description: Description of target: This gene encodes one of the proteins of the highly conserved urothelium-specific integral membrane proteins of the asymmetric unit membrane which forms urothelium apical plaques in mammals. The asymmetric unit membrane is believed to strengthen the urothelium by preventing cell rupture during bladder distention. The encoded protein is expressed in the peripheral blood of bladder cancer patients with transitional cell carcinomas.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.053 ng/mL

UPK2 Protein Vector (Human) (pPB-C-His)

PV059577 500 ng
EUR 481

UPK2 Protein Vector (Human) (pPB-N-His)

PV059578 500 ng
EUR 481

UPK2 Protein Vector (Human) (pPM-C-HA)

PV059579 500 ng
EUR 481

UPK2 Protein Vector (Human) (pPM-C-His)

PV059580 500 ng
EUR 481

UPK2 Polyclonal Conjugated Antibody

C27504 100ul
EUR 397

Uroplakin-2 (UPK2) Antibody

20-abx126762
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Uroplakin 2 (UPK2) Antibody

20-abx116547
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Uroplakin 2 (UPK2) Antibody

20-abx131673
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Uroplakin-2 (UPK2) Antibody

20-abx002383
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Uroplakin-2 (UPK2) Antibody

abx239274-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Mouse Uroplakin-2 (Upk2)

1-CSB-EP025656MO
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 40.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Uroplakin-2(Upk2) expressed in E.coli

Human Uroplakin- 2, UPK2 ELISA KIT

ELI-36740h 96 Tests
EUR 824

Human Uroplakin 2 (UPK2) ELISA Kit

20-abx156911
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Uroplakin 2 (UPK2) CLIA Kit

20-abx494951
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

UPK2 sgRNA CRISPR Lentivector set (Human)

K2591901 3 x 1.0 ug
EUR 339

Uroplakin 2 (UPK2) Polyclonal Antibody (Human)

4-PAF561Hu01
  • EUR 261.00
  • EUR 2734.00
  • EUR 676.00
  • EUR 330.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UPK2 (Asp26~Thr153)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Uroplakin 2 (UPK2)

Human Uroplakin 2 ELISA Kit (UPK2)

RK02481 96 Tests
EUR 521

Human Uroplakin 2(UPK2)ELISA Kit

QY-E02051 96T
EUR 374

Human Uroplakin 2 (UPK2) ELISA Kit

SEF561Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Uroplakin 2 (UPK2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uroplakin 2 (UPK2) in tissue homogenates, cell lysates and other biological fluids.

Human Uroplakin 2 (UPK2) ELISA Kit

SEF561Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Uroplakin 2 (UPK2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uroplakin 2 (UPK2) in tissue homogenates, cell lysates and other biological fluids.

Human Uroplakin 2 (UPK2) ELISA Kit

SEF561Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Uroplakin 2 (UPK2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uroplakin 2 (UPK2) in tissue homogenates, cell lysates and other biological fluids.

Human Uroplakin 2 (UPK2) ELISA Kit

SEF561Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Uroplakin 2 (UPK2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uroplakin 2 (UPK2) in tissue homogenates, cell lysates and other biological fluids.

Human Uroplakin 2 (UPK2) ELISA Kit

4-SEF561Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Uroplakin 2 elisa. Alternative names of the recognized antigen: UPII
  • Uroplakin II
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Uroplakin 2 (UPK2) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

UPK2 Protein Vector (Rat) (pPB-C-His)

PV314586 500 ng
EUR 603

UPK2 Protein Vector (Rat) (pPB-N-His)

PV314587 500 ng
EUR 603

UPK2 Protein Vector (Rat) (pPM-C-HA)

PV314588 500 ng
EUR 603

UPK2 Protein Vector (Rat) (pPM-C-His)

PV314589 500 ng
EUR 603

UPK2 Protein Vector (Mouse) (pPB-C-His)

PV244278 500 ng
EUR 603

UPK2 Protein Vector (Mouse) (pPB-N-His)

PV244279 500 ng
EUR 603

UPK2 Protein Vector (Mouse) (pPM-C-HA)

PV244280 500 ng
EUR 603

UPK2 Protein Vector (Mouse) (pPM-C-His)

PV244281 500 ng
EUR 603

Uroplakin 2 (UPK2) Antibody (Cy3)

20-abx274287
  • EUR 592.00
  • EUR 286.00
  • EUR 1887.00
  • EUR 857.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Upk2 ORF Vector (Rat) (pORF)

ORF078647 1.0 ug DNA
EUR 506

Upk2 ORF Vector (Mouse) (pORF)

ORF061070 1.0 ug DNA
EUR 506

ELISA kit for Human UPK2 (Uroplakin 2)

ELK5223 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Uroplakin 2 (UPK2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Uroplakin 2 (UP
  • Show more
Description: A sandwich ELISA kit for detection of Uroplakin 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

UPK2 sgRNA CRISPR Lentivector (Human) (Target 1)

K2591902 1.0 ug DNA
EUR 154

UPK2 sgRNA CRISPR Lentivector (Human) (Target 2)

K2591903 1.0 ug DNA
EUR 154

UPK2 sgRNA CRISPR Lentivector (Human) (Target 3)

K2591904 1.0 ug DNA
EUR 154

Uroplakin 2 (UPK2) Polyclonal Antibody (Human), APC

4-PAF561Hu01-APC
  • EUR 367.00
  • EUR 3581.00
  • EUR 989.00
  • EUR 470.00
  • EUR 228.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UPK2 (Asp26~Thr153)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Uroplakin 2 (UPK2). This antibody is labeled with APC.

Uroplakin 2 (UPK2) Polyclonal Antibody (Human), Biotinylated

4-PAF561Hu01-Biotin
  • EUR 327.00
  • EUR 2684.00
  • EUR 783.00
  • EUR 403.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UPK2 (Asp26~Thr153)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Uroplakin 2 (UPK2). This antibody is labeled with Biotin.

Uroplakin 2 (UPK2) Polyclonal Antibody (Human), Cy3

4-PAF561Hu01-Cy3
  • EUR 447.00
  • EUR 4733.00
  • EUR 1277.00
  • EUR 585.00
  • EUR 263.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UPK2 (Asp26~Thr153)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Uroplakin 2 (UPK2). This antibody is labeled with Cy3.

Uroplakin 2 (UPK2) Polyclonal Antibody (Human), FITC

4-PAF561Hu01-FITC
  • EUR 313.00
  • EUR 2884.00
  • EUR 811.00
  • EUR 396.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UPK2 (Asp26~Thr153)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Uroplakin 2 (UPK2). This antibody is labeled with FITC.

Uroplakin 2 (UPK2) Polyclonal Antibody (Human), HRP

4-PAF561Hu01-HRP
  • EUR 334.00
  • EUR 3120.00
  • EUR 873.00
  • EUR 424.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UPK2 (Asp26~Thr153)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Uroplakin 2 (UPK2). This antibody is labeled with HRP.

Uroplakin 2 (UPK2) Polyclonal Antibody (Human), PE

4-PAF561Hu01-PE
  • EUR 313.00
  • EUR 2884.00
  • EUR 811.00
  • EUR 396.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UPK2 (Asp26~Thr153)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Uroplakin 2 (UPK2). This antibody is labeled with PE.

Uroplakin 2 (UPK2) Polyclonal Antibody (Human), APC-Cy7

4-PAF561Hu01-APC-Cy7
  • EUR 614.00
  • EUR 7042.00
  • EUR 1858.00
  • EUR 821.00
  • EUR 337.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UPK2 (Asp26~Thr153)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Uroplakin 2 (UPK2). This antibody is labeled with APC-Cy7.

Mouse Uroplakin- 2, Upk2 ELISA KIT

ELI-36741m 96 Tests
EUR 865

Bovine Uroplakin- 2, UPK2 ELISA KIT

ELI-28839b 96 Tests
EUR 928

Porcine Uroplakin- 2, UPK2 ELISA KIT

ELI-39864p 96 Tests
EUR 928

Upk2 sgRNA CRISPR Lentivector set (Mouse)

K3928801 3 x 1.0 ug
EUR 339

Upk2 sgRNA CRISPR Lentivector set (Rat)

K6692301 3 x 1.0 ug
EUR 339

Upk2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3928802 1.0 ug DNA
EUR 154

Upk2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3928803 1.0 ug DNA
EUR 154

Upk2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3928804 1.0 ug DNA
EUR 154

Upk2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6692302 1.0 ug DNA
EUR 154

Upk2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6692303 1.0 ug DNA
EUR 154

Upk2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6692304 1.0 ug DNA
EUR 154

Upk2 3'UTR GFP Stable Cell Line

TU171611 1.0 ml Ask for price

UPK2 3'UTR GFP Stable Cell Line

TU077868 1.0 ml
EUR 1394

Upk2 3'UTR Luciferase Stable Cell Line

TU121611 1.0 ml Ask for price

UPK2 3'UTR Luciferase Stable Cell Line

TU027868 1.0 ml
EUR 1394

Upk2 3'UTR Luciferase Stable Cell Line

TU222886 1.0 ml Ask for price

Upk2 3'UTR GFP Stable Cell Line

TU272886 1.0 ml Ask for price

UPK2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K2591905 3 x 1.0 ug
EUR 376

UPK2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV651097 1.0 ug DNA
EUR 514

UPK2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV651101 1.0 ug DNA
EUR 514

UPK2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV651102 1.0 ug DNA
EUR 514

UPK2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K2591906 1.0 ug DNA
EUR 167

UPK2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K2591907 1.0 ug DNA
EUR 167

UPK2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K2591908 1.0 ug DNA
EUR 167

Upk2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3928805 3 x 1.0 ug
EUR 376

Upk2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6692305 3 x 1.0 ug
EUR 376

Upk2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3928806 1.0 ug DNA
EUR 167

Upk2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3928807 1.0 ug DNA
EUR 167

Upk2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3928808 1.0 ug DNA
EUR 167

UPK2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV651098 1.0 ug DNA
EUR 514

UPK2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV651099 1.0 ug DNA
EUR 572

UPK2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV651100 1.0 ug DNA
EUR 572

Upk2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6692306 1.0 ug DNA
EUR 167

Upk2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6692307 1.0 ug DNA
EUR 167

Upk2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6692308 1.0 ug DNA
EUR 167

STAG3L1 Recombinant Protein (Human) (Recombinant Tag)

RP030283 100 ug Ask for price

STAG3L2 Recombinant Protein (Human) (Recombinant Tag)

RP030286 100 ug Ask for price

STAG3L3 Recombinant Protein (Human) (Recombinant Tag)

RP030289 100 ug Ask for price

STAG3L4 Recombinant Protein (Human) (Recombinant Tag)

RP030292 100 ug Ask for price

TAGAP Recombinant Protein (Human) (Recombinant- Tag)

RP030880 100 ug Ask for price

TAGLN Recombinant Protein (Human) (Recombinant- Tag)

RP030883 100 ug Ask for price

TAGLN Recombinant Protein (Human) (Recombinant- Tag)

RP030886 100 ug Ask for price

TAGLN2 Recombinant Protein (Human) (Recombinant Tag)

RP030889 100 ug Ask for price

TAGLN2 Recombinant Protein (Human) (Recombinant Tag)

RP030892 100 ug Ask for price

TAGLN3 Recombinant Protein (Human) (Recombinant Tag)

RP030895 100 ug Ask for price

CTAG1A Recombinant Protein (Human) (Recombinant- Tag)

RP038332 100 ug Ask for price

CTAG1B Recombinant Protein (Human) (Recombinant- Tag)

RP038335 100 ug Ask for price

CTAGE5 Recombinant Protein (Human) (Recombinant- Tag)

RP038338 100 ug Ask for price

TAGAP Recombinant Protein (Human) (Recombinant- Tag)

RP043930 100 ug Ask for price

CTAGE3P